Ai Digital Biology

Programming in Four Bits: Genome Compiler

The rise of synthetic biology and automated genetic engineering has led to a problem: there is simply far too many genetic sequences flying around everywhere to keep up. Cloning processes are difficult enough at the small scales usually seen in academia, keeping track of a couple of vectors, a few site mutations, different hosts – but this becomes orders of magnitude more complex when dealing with industrial scale genetic engineering. Worse than this is the format, very few people are able to look at sequences such as GGATCTAATGGCGAACCTTGGCTGCT and immediately recognise where protein coding begins – let alone identify that a signal peptide follows directly after.

This is where software such as that produced by Genome Compiler Corp. comes into play

Their aim is to develop an all-in-one software platform designed for genetic engineers and synthetic biologists. At its core, this means that they have a powerful system able to assist in visualising DNA, both for examination and to assist in design. This is linked into tools for data management (to keep your hundreds of sequences organised) and collaborative workflow (to keep the company’s thousands of sequences organised).Genome Compiler was founded by Omri Amirav-Drory (the current CEO), Yogev Debbi (current COO), Roy Nevo (CTO), and Nir Ben Moshe. The firm was in the first batch of graduates from the NFX Guild accelerator program, having been recommended to the program by tech scouts. They have built upon this earlier success with a slew of collaborations including DNA2.0, Sigma-Aldrich, and Amyris. The Amyris collaboration, which involves integration of Amyris’ automated laboratory services with Genome Compilers online design tools, will be open to early users soon.One of the founders of Genome Compiler Corp was Omri Amirav-Drory, who will be speaking at the upcoming SynBioBeta SF conference. After gaining his PhD in Biochemistry, Omri moved from Tel Aviv to Stanford to do his postdoc. There his interest in synthetic biology was piqued by attending Stanford’s first Introduction to Synthetic Biology course, an interest which was further fuelled by Craig Venter’s announcement of the first synthetic genome. It was during this time that Omri began to realise that the costs for both synthesising and sequencing DNA were rapidly decreasing, but that the software behind these achievements was not yet up to scratch. At the time Stanford was (and still is) at the cutting edge of research, and so the problems he was having while performing experiments were likely to be occurring for others in the next couple of years.

Omri Amirav-Drory at SynBioBeta London 2015.

Omri Amirav-Drory at SynBioBeta London 2015.Stanford has a strong focus on entrepreneurship and commercialisation of innovation – their accelerator program (StartX) has supported the founding of over 240 companies so far while the AIMS group supports postdocs interested in industry. Indeed, Omri comments that, while in this atmosphere, “you realise you are no different from anyone else – you can do it all too”.An early success was the Glowing Plant project, considered a posterchild for both consumer synthetic biology and crowdfunding as development income stream. Essentially a transformed strain of Arabidopsis expressing a luminescent protein (i.e. a glowing plant), the project was conceived of by Omri as a way to show the power of synthetic biology to the world, to “change people’s thinking about GMOs and show something beautiful”.The program was supported by donations through Kickstarter, a well-known crowdfunding site, which served both as a marketing tool and a way to gather pre-payments from interested consumers. Although somewhat controversial (leading directly to Kickstarter changing their rules to disallow GMO funding) and not as successful as Omri hoped (“I thought we would raise 10 million”), it nonetheless inspired significant interest in synthetic biology and led to success for TAXA, the plant genetic-engineering company founded for the project.

The disconnect between bits and atoms

Omri’s goal for Genome Compiler is to act as a front end for the vast number of synthetic biology service providers currently in business – “we want to be Switzerland, to work with everyone” (although, sadly, not to the point of making their own delicious chocolate). Thus users of their software will be able to design, optimise, and purchase everything they need through one portal.There is currently a gap between computational and wet-lab biology – a “disconnect between bits and atoms” – in that researchers who have designed their sequence on the computer still need to go into the lab and start cloning. The aim of Genome Compiler is to seamlessly link the two together, allowing researchers to go from genetic idea through to delivered plasmid in one motion.Are there difficulties ahead? Naturally! As Omri commented, the major problem for the entire field of synthetic biology is that the expected drop in DNA synthesis prices has not yet occurred – particularly at the scale which he is interested in. Ideally prices would reduce to 1-2c per base pair, an occurrence which he expects by 2020 at the latest. Once this occurs, with the ability to synthesise long sequences, he believes that we “can just forget about molecular biology” – as the requirement to perform tedious cloning steps will be eliminated by the ability to simply purchase individualised sequences.This is actually the smallest of the changes which he sees sweeping the biotech world in the near future, in particular his prediction that “biologists in the future will be more like software engineers”. What does this mean? The majority of lab techniques today are manually performed, repetitive, and tedious – all factors which support the implementation of automated techniques. With the rise of algorithmic processes for protein and gene design, the potential for a computer system to design a protein, order the gene and then optimise its expression is getting nearer and nearer.This technology is not yet available, although as Omri comments: “as a start-up, you can’t really wait. So we’re doing it ourselves, to make it happen”. What are they planning next? Well – you’d better come and see his talk.Omri will be speaking in Session 2 of the upcoming SynBioBeta SF 2015 conference.

Read More
Newletter & More

SynBioBeta

Join the innovators shaping the future with SynBio + AI. From health to ag, materials & more—be part of the revolution.